ID: 1183481746_1183481760

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1183481746 1183481760
Species Human (GRCh38) Human (GRCh38)
Location 22:38069108-38069130 22:38069147-38069169
Sequence CCATCCTGTGCAATGGTGAGTCC GGCCCCGGGGACTCAAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 216} {0: 1, 1: 0, 2: 1, 3: 22, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!