ID: 1183485075_1183485094

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1183485075 1183485094
Species Human (GRCh38) Human (GRCh38)
Location 22:38084204-38084226 22:38084255-38084277
Sequence CCTGCTAAGAGGCTTTTGTCCAG CCAGGCTGGGCCTCGGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106} {0: 1, 1: 0, 2: 0, 3: 20, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!