ID: 1183504739_1183504745

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1183504739 1183504745
Species Human (GRCh38) Human (GRCh38)
Location 22:38202717-38202739 22:38202747-38202769
Sequence CCGCGCGCGCGCTCCCTGGGGCC CAGCAGTGTGTACCTCGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 257} {0: 1, 1: 0, 2: 1, 3: 9, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!