ID: 1183540083_1183540087

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1183540083 1183540087
Species Human (GRCh38) Human (GRCh38)
Location 22:38424777-38424799 22:38424802-38424824
Sequence CCGGAGACCTTGCAGCTTCTACC TGCCCTCGTAGGTTGCTGCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!