ID: 1183551488_1183551494

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1183551488 1183551494
Species Human (GRCh38) Human (GRCh38)
Location 22:38489450-38489472 22:38489490-38489512
Sequence CCGGAGAACCTGGGTTCGGGTAA ACGCCTCCCCCAAGGATAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66} {0: 1, 1: 0, 2: 1, 3: 8, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!