ID: 1183677476_1183677482

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1183677476 1183677482
Species Human (GRCh38) Human (GRCh38)
Location 22:39307568-39307590 22:39307584-39307606
Sequence CCTCCCTGTGAAAACAGAAGTGA GAAGTGATGCCGGGGCTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 280} {0: 1, 1: 0, 2: 1, 3: 19, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!