ID: 1183929842_1183929847

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1183929842 1183929847
Species Human (GRCh38) Human (GRCh38)
Location 22:41229727-41229749 22:41229753-41229775
Sequence CCACCTGGGCACAGAAGAGTAGA AGGTTTCTTTGGCATTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 218} {0: 1, 1: 1, 2: 4, 3: 59, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!