ID: 1183937889_1183937892

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1183937889 1183937892
Species Human (GRCh38) Human (GRCh38)
Location 22:41274306-41274328 22:41274344-41274366
Sequence CCACCTCACATGTGACAGCTCTG CTCCCTACTTTGTCTTTCACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!