ID: 1184306757_1184306761

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1184306757 1184306761
Species Human (GRCh38) Human (GRCh38)
Location 22:43608284-43608306 22:43608310-43608332
Sequence CCATCCACCAAGGCTGCTTGCTA GCACCAAGCAGCAAGGAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 216} {0: 1, 1: 0, 2: 2, 3: 17, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!