ID: 1184378978_1184378984

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1184378978 1184378984
Species Human (GRCh38) Human (GRCh38)
Location 22:44133162-44133184 22:44133208-44133230
Sequence CCGAGATAAATGATTGGAACGGG AGGCAGAAGCAGAGGCATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73} {0: 1, 1: 0, 2: 8, 3: 70, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!