ID: 1184384814_1184384820

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1184384814 1184384820
Species Human (GRCh38) Human (GRCh38)
Location 22:44167950-44167972 22:44167991-44168013
Sequence CCCACCTGCTCTCTCAGTAACCG GTGATCAGGACTAAAGCACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!