ID: 1184408381_1184408390

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1184408381 1184408390
Species Human (GRCh38) Human (GRCh38)
Location 22:44312993-44313015 22:44313019-44313041
Sequence CCTGCAGGAGTCCAGCTCCCGCC GCCTAGGGCCGCCACCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 231} {0: 1, 1: 0, 2: 2, 3: 17, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!