ID: 1184408385_1184408390

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1184408385 1184408390
Species Human (GRCh38) Human (GRCh38)
Location 22:44313004-44313026 22:44313019-44313041
Sequence CCAGCTCCCGCCTGGGCCTAGGG GCCTAGGGCCGCCACCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 307} {0: 1, 1: 0, 2: 2, 3: 17, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!