ID: 1184523951_1184523963

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1184523951 1184523963
Species Human (GRCh38) Human (GRCh38)
Location 22:45010366-45010388 22:45010418-45010440
Sequence CCCTCCTCCGCCTCCCTCTGATA TCCATACCAGCGCCGCGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 547} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!