ID: 1184620419_1184620434

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1184620419 1184620434
Species Human (GRCh38) Human (GRCh38)
Location 22:45672233-45672255 22:45672268-45672290
Sequence CCGCGGCGGCCCCGGCCTGGACC CCGCCTCGCTGGAGACGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 364} {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!