ID: 1184650079_1184650091

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1184650079 1184650091
Species Human (GRCh38) Human (GRCh38)
Location 22:45915644-45915666 22:45915692-45915714
Sequence CCCAGCTCCCACTAACTCCATCT CTCGCCGCTTCCTTTCCCTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!