ID: 1184663730_1184663750

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1184663730 1184663750
Species Human (GRCh38) Human (GRCh38)
Location 22:45976999-45977021 22:45977041-45977063
Sequence CCGGTTGAGCGACCGTGGACCCC CCCGGGCGCGGCTGGCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 27} {0: 1, 1: 1, 2: 2, 3: 57, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!