ID: 1184689920_1184689934

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1184689920 1184689934
Species Human (GRCh38) Human (GRCh38)
Location 22:46112863-46112885 22:46112901-46112923
Sequence CCCTGGCTGGGAGCGGGCAGGGC CCTTGGCAGCAGTCGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 517} {0: 1, 1: 0, 2: 1, 3: 12, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!