ID: 1184709970_1184709983

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1184709970 1184709983
Species Human (GRCh38) Human (GRCh38)
Location 22:46244120-46244142 22:46244170-46244192
Sequence CCAGAGCTCACAGATCAGTGTCC GGAGATGGGGAGCCTGGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 176} {0: 1, 1: 1, 2: 8, 3: 65, 4: 678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!