ID: 1184776691_1184776699

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1184776691 1184776699
Species Human (GRCh38) Human (GRCh38)
Location 22:46626958-46626980 22:46626975-46626997
Sequence CCCTGTGAGTACCTGTCCTCGTC CTCGTCCCCCGGTGTGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 106} {0: 1, 1: 0, 2: 3, 3: 4, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!