ID: 1184784038_1184784048

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1184784038 1184784048
Species Human (GRCh38) Human (GRCh38)
Location 22:46663213-46663235 22:46663244-46663266
Sequence CCCCGGTCCCTGGGCTGAGGCTG GGGCCATCCTTTATCACCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 379} {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!