ID: 1185057380_1185057389

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1185057380 1185057389
Species Human (GRCh38) Human (GRCh38)
Location 22:48588038-48588060 22:48588059-48588081
Sequence CCCCTTGGCCAAGCTCCATCTGT GTGCATAATGGGGGCTCCAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!