ID: 1185109920_1185109931

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1185109920 1185109931
Species Human (GRCh38) Human (GRCh38)
Location 22:48895113-48895135 22:48895154-48895176
Sequence CCCGGCGCCTTCCACCTGGGCAG GGCTTCAGACTCCTGGCCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 298} {0: 1, 1: 0, 2: 8, 3: 184, 4: 3599}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!