ID: 1185268878_1185268883

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1185268878 1185268883
Species Human (GRCh38) Human (GRCh38)
Location 22:49919106-49919128 22:49919121-49919143
Sequence CCACCGTGGAACCAGGGTCGACG GGTCGACGCCACCGTGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26} {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!