ID: 1185270431_1185270438

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1185270431 1185270438
Species Human (GRCh38) Human (GRCh38)
Location 22:49927072-49927094 22:49927101-49927123
Sequence CCTCATCTCTCATCTGCTTTGTG GGGGGTCTCCGAGCTGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 438} {0: 1, 1: 0, 2: 0, 3: 10, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!