ID: 1185295018_1185295030

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1185295018 1185295030
Species Human (GRCh38) Human (GRCh38)
Location 22:50048961-50048983 22:50048994-50049016
Sequence CCTCAGCTTCCACATGCGCACAG CAGTGTGGGTGGAGGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!