ID: 1185320518_1185320527

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1185320518 1185320527
Species Human (GRCh38) Human (GRCh38)
Location 22:50198441-50198463 22:50198483-50198505
Sequence CCGCACCGCGAGCCTGGTCCTGT CTGCCTGCAGAGGGTGACCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95} {0: 1, 1: 0, 2: 1, 3: 29, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!