ID: 1185377780_1185377789

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1185377780 1185377789
Species Human (GRCh38) Human (GRCh38)
Location 22:50489991-50490013 22:50490040-50490062
Sequence CCCCTCACGGCAACTTGTGCCTG TGTGCTTCTGAAGCCCCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 122, 4: 1880} {0: 1, 1: 0, 2: 1, 3: 24, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!