ID: 1185379944_1185379956

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1185379944 1185379956
Species Human (GRCh38) Human (GRCh38)
Location 22:50503699-50503721 22:50503741-50503763
Sequence CCTGTGGGAGGGAGGGAGGGAGG CTGGGTTTACCCCGGGAGGCTGG
Strand - +
Off-target summary {0: 2, 1: 15, 2: 73, 3: 311, 4: 1370} {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!