ID: 1185585037_1185585046

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1185585037 1185585046
Species Human (GRCh38) Human (GRCh38)
Location X:1236476-1236498 X:1236500-1236522
Sequence CCCTACTGGGAAGTGAGCCCCTC GCCCTCTGGGCCCGTCTGGGAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 31, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!