ID: 1185619332_1185619341

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1185619332 1185619341
Species Human (GRCh38) Human (GRCh38)
Location X:1443857-1443879 X:1443900-1443922
Sequence CCATCGTGGACAGACACCGCCGT ATGGACACACACCGCCATCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!