ID: 1185727452_1185727456

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1185727452 1185727456
Species Human (GRCh38) Human (GRCh38)
Location X:2433598-2433620 X:2433630-2433652
Sequence CCTGCGTCCCTGTGTTCTCACTG TACTTGTAAGTGAGAACATGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!