ID: 1185778758_1185778768

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1185778758 1185778768
Species Human (GRCh38) Human (GRCh38)
Location X:2828706-2828728 X:2828723-2828745
Sequence CCGCCGACTGCCGAAGGGGCCGC GGCCGCGGCGGGCGAGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 60} {0: 1, 1: 1, 2: 27, 3: 168, 4: 1270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!