ID: 1185877599_1185877614

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1185877599 1185877614
Species Human (GRCh38) Human (GRCh38)
Location X:3713239-3713261 X:3713279-3713301
Sequence CCCGGGCGCCTCCATGGGGACGC CGGGCCAGGCCGGAGCGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 0, 3: 5, 4: 110} {0: 3, 1: 3, 2: 3, 3: 16, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!