ID: 1186126710_1186126716

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1186126710 1186126716
Species Human (GRCh38) Human (GRCh38)
Location X:6422295-6422317 X:6422324-6422346
Sequence CCTGTCGTCTCACAGTCCTGGCT ATGCGTGTGGAGCCCTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 134} {0: 1, 1: 0, 2: 4, 3: 2, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!