ID: 1186430715_1186430718

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1186430715 1186430718
Species Human (GRCh38) Human (GRCh38)
Location X:9502012-9502034 X:9502028-9502050
Sequence CCATGCGCCACATGTGGCTGTGG GCTGTGGAGTGCTTGAAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 298} {0: 1, 1: 2, 2: 39, 3: 194, 4: 672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!