ID: 1186611639_1186611644

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1186611639 1186611644
Species Human (GRCh38) Human (GRCh38)
Location X:11143738-11143760 X:11143771-11143793
Sequence CCAGATATCTGAGACTTGGAGTG GGACCCTCCCAGCCAACGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122} {0: 1, 1: 0, 2: 1, 3: 13, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!