ID: 1186760869_1186760876

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1186760869 1186760876
Species Human (GRCh38) Human (GRCh38)
Location X:12720653-12720675 X:12720682-12720704
Sequence CCAAATCAAGACCCTAATGATTT AGCAAATCAGGCATACGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 444, 4: 700} {0: 1, 1: 0, 2: 1, 3: 5, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!