ID: 1186835152_1186835166

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1186835152 1186835166
Species Human (GRCh38) Human (GRCh38)
Location X:13430276-13430298 X:13430326-13430348
Sequence CCCTTAGCAGGTATTCTCTTTGG CTCTAGACACAGGGGAAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!