ID: 1187400362_1187400365

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1187400362 1187400365
Species Human (GRCh38) Human (GRCh38)
Location X:18954226-18954248 X:18954254-18954276
Sequence CCGAGATACAGCTGTCAGTCACT CTGCTCCAGCTCGTAGGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157} {0: 1, 1: 0, 2: 0, 3: 18, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!