ID: 1187507115_1187507137

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1187507115 1187507137
Species Human (GRCh38) Human (GRCh38)
Location X:19887196-19887218 X:19887230-19887252
Sequence CCCCGTCCGGACCCTGCCCCCGG GGGCTCCGCGGTTCTGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 270} {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!