ID: 1187730241_1187730243

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1187730241 1187730243
Species Human (GRCh38) Human (GRCh38)
Location X:22245377-22245399 X:22245395-22245417
Sequence CCAAATTGGTGCTCACAGTCCCC TCCCCCTCAGTTTAGGTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127} {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!