ID: 1188976651_1188976655

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1188976651 1188976655
Species Human (GRCh38) Human (GRCh38)
Location X:36683541-36683563 X:36683578-36683600
Sequence CCTTCCACCATCTGCTCACTCAG TATCTGTCTTTAAATGTTTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!