ID: 1189044068_1189044082

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1189044068 1189044082
Species Human (GRCh38) Human (GRCh38)
Location X:37572217-37572239 X:37572264-37572286
Sequence CCCGCGCCGCCTTCCTGCTCGGG ACGCTCGTATACCACGCCCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 22, 4: 212} {0: 2, 1: 0, 2: 0, 3: 1, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!