ID: 1189058626_1189058633

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1189058626 1189058633
Species Human (GRCh38) Human (GRCh38)
Location X:37727881-37727903 X:37727913-37727935
Sequence CCCTGGATCCTCTTCTGGTGCAG ATTCCCTGAGAACATAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 166} {0: 1, 1: 0, 2: 3, 3: 22, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!