ID: 1189276115_1189276119

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1189276115 1189276119
Species Human (GRCh38) Human (GRCh38)
Location X:39787326-39787348 X:39787345-39787367
Sequence CCTTGAGGGGGCCCTCCGATGCC TGCCTGCTTCACCACCTTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 37, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!