ID: 1189336604_1189336611

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1189336604 1189336611
Species Human (GRCh38) Human (GRCh38)
Location X:40174327-40174349 X:40174352-40174374
Sequence CCCTTCACAGCCTCCGGCCCCTA AGACGCTCCCAGCCAGCCTCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!