|
Left Crispr |
Right Crispr |
Crispr ID |
1189345412 |
1189345420 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
X:40237479-40237501
|
X:40237516-40237538
|
Sequence |
CCTCAGCCTCCCGAGTAGGTGGG |
CCACCATGCCTGGCTAAAAGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 945, 1: 103301, 2: 284909, 3: 226195, 4: 127508} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|