ID: 1189345412_1189345420

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1189345412 1189345420
Species Human (GRCh38) Human (GRCh38)
Location X:40237479-40237501 X:40237516-40237538
Sequence CCTCAGCCTCCCGAGTAGGTGGG CCACCATGCCTGGCTAAAAGTGG
Strand - +
Off-target summary {0: 945, 1: 103301, 2: 284909, 3: 226195, 4: 127508} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!