ID: 1189794401_1189794406

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1189794401 1189794406
Species Human (GRCh38) Human (GRCh38)
Location X:44633712-44633734 X:44633739-44633761
Sequence CCTAGAGAGCGGCCAACTCCTTG GGTGCTCCGCTGCCACCTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!