ID: 1189893774_1189893782

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1189893774 1189893782
Species Human (GRCh38) Human (GRCh38)
Location X:45632643-45632665 X:45632671-45632693
Sequence CCTGCTTGGCCCGCTGCAGAACG CAGCTCGGACAACTTGGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 17, 4: 68} {0: 1, 1: 5, 2: 7, 3: 20, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!